Table 4 of
Hunter, Mol Vis 2007;
13:431-442.
Table 4. Primer sequences used for association testing and genomic location of amplicons
The exact location of COS18* and PAX6 exon 7** could not be determined in the current canine genome draft sequence. The site given for COS18 represents the region between its flanking markers BAC_375-H17 and BAC_373-K16 [24,25]. The site given for exon 7 represents the last sequence before a gap in the genome which occurs in intron 4, and the calculated location of the beginning of exon 8, which is also located within the gap.
Product Distance Tm size Canine genomic between Primer name Primer sequence (°C) (bp) sequence location markers ------------------------- ----------------------- ---- ------- ------------------------- -------- C18.156-F (AC)15 ACAACCAACACACACAAAAACC 54.7 136 Chr18:25401870+25402003 C18.156-R (AC)15 TGTTATCCCAGTGGCATTAGG 54.5 2.2 Mb COS-18-F (TC)19 CGTGGTGCCGGCCCTTTGAT 63.4 360 Chr18:27577535-30076377* COS-18-R (TC)19 TTTAGCGCCTGCCTTTGGAC 58.4 8.1 Mb Wilms-TF-F (tetra repeat) CCCAATCTCCAGAGATTTTCC 52.3 300 Chr18:38163822+38164112 Wilms-TF-R (tetra repeat) CCAGTCTCAGCTGTGTCCAA 53.7 510 Kb PAX6-51F (exon 7 SNP) GTTGTTCTTTAAGAGAGTGGGTG 53.5 310 Chr18:38675041-38687464** PAX6-52R (exon 7 SNP) CCAGTGGCTGCCTATATGGAG 57.3 2.8 Kb PAX6-30F (intron 8 SNP) GCCACATCTTCAGTACAAAG 49.6 824 Chr18:38687699+38688522 PAX6-21R (intron 8 SNP) GCCTGTCTTCTCTGGTTCC 53.1 6.6 Mb REN47J11-F (CA)11 TCTCCTCGCGTGTTTCTG 50.2 163 Chr18:45329434-45329603 REN47J11-R (CA)11 GGGGACACTCAGAAGGACG 55.3 |