Table 4 of Hunter, Mol Vis 2007; 13:431-442.


Table 4. Primer sequences used for association testing and genomic location of amplicons

The exact location of COS18* and PAX6 exon 7** could not be determined in the current canine genome draft sequence. The site given for COS18 represents the region between its flanking markers BAC_375-H17 and BAC_373-K16 [24,25]. The site given for exon 7 represents the last sequence before a gap in the genome which occurs in intron 4, and the calculated location of the beginning of exon 8, which is also located within the gap.

                                                             Product                               Distance
                                                       Tm     size          Canine genomic         between
       Primer name              Primer sequence       (°C)    (bp)         sequence location       markers
-------------------------   -----------------------   ----   -------   -------------------------   --------
C18.156-F (AC)15            ACAACCAACACACACAAAAACC    54.7     136     Chr18:25401870+25402003
C18.156-R (AC)15            TGTTATCCCAGTGGCATTAGG     54.5                                          2.2 Mb

COS-18-F (TC)19             CGTGGTGCCGGCCCTTTGAT      63.4     360     Chr18:27577535-30076377*
COS-18-R (TC)19             TTTAGCGCCTGCCTTTGGAC      58.4                                          8.1 Mb

Wilms-TF-F (tetra repeat)   CCCAATCTCCAGAGATTTTCC     52.3     300     Chr18:38163822+38164112
Wilms-TF-R (tetra repeat)   CCAGTCTCAGCTGTGTCCAA      53.7                                          510 Kb

PAX6-51F (exon 7 SNP)       GTTGTTCTTTAAGAGAGTGGGTG   53.5     310     Chr18:38675041-38687464**
PAX6-52R (exon 7 SNP)       CCAGTGGCTGCCTATATGGAG     57.3                                          2.8 Kb

PAX6-30F (intron 8 SNP)     GCCACATCTTCAGTACAAAG      49.6     824     Chr18:38687699+38688522
PAX6-21R (intron 8 SNP)     GCCTGTCTTCTCTGGTTCC       53.1                                          6.6 Mb

REN47J11-F (CA)11           TCTCCTCGCGTGTTTCTG        50.2     163     Chr18:45329434-45329603
REN47J11-R (CA)11           GGGGACACTCAGAAGGACG       55.3

Hunter, Mol Vis 2007; 13:431-442 <http://www.molvis.org/molvis/v13/a46/>
©2007 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535