Table 2 of Nallasamy, Mol Vis 2007; 13:229-236.


Table 2. Primers designed for mutation screening

Forward and reverse primers designed for PCDH15 and ZWINT for mutation screening.

  Exon           Forward Primer                Reverse Primer
--------   ---------------------------   ---------------------------
   PCDH15

1          TCACTTGCAATCATTACTACTCTAT     GGCTGACGAACACAGTACAATA
2          AAAAATCCTGGCTCGCTCTA          AATGTGGCACAGGTAATTAACTATG
3          TTATTCCAAGTAAAGCATGA          TTTTCCTTTTTAAATATTAATATAC
4          AAATGAGTTAAAGAAACTGTTGT       TATTTTCTGTCTTATGCTAGATATA
5          GTTTTCTTGATATTTCTAAACAGTT     TGTACTGAATGAACGAGTGCT
6          AATAATAGTATCATTACTAATCTGG     GAGCTGATTTTTATGCTGTAACA
7          ATGAAGAAGTGAGTGGCACA          TTCTATTTTCAGATGATAAGCATGT
8          AAAATAAAATAACCATGTTGGACT      TTTTTGTTGTTGTTTTTTGAGACTG
9          AAATATTTCCTTGGAATTGA          TGAGTTTACTGTCTCAGACGTTATA
10         TAACATAAAACTGCCTACAGTAGCG     TTTGTTCCTCAGCTGATGAAGGG
11         TTAATTCTCTCTTCTCTAGCTTATG     ATTAGTTAAAAAGAGAACCCTATA
12         CCAGACATCTCTTTCAGTTCCATAC     TCTTAATACTTTCACGTGGAT
13         TAATTTCTTCATGAGCATATCGTAT     CCTTTCAAATTGTAAGATTACCTG
14         AAGAATACTTGCCGCGCTTC          TTGTTGGGGGAAAAAACGACATGGT
15         CAGATGGAATTTTCATTCACTAGAG     AACAACTGAATAAACAATGCAGTC
16         AGAAAACAGAAAGGGAAGTACAAC      GATACGAAATGTTTGATTTTACACC
17         TGATTACTGAGAGGGGAAA           TGTCAAGTCAAAGGTTGCAGC
18         TTCAGATAGACAAATGCCAGAA        AGTCTTGAAGAATATCCAGCACA
19         ATTGTCATTGTCATTTCCTCCTT       GGCACACAAACCCTAATAGCA
20         GTCCTCGTTAAATTGATGCTGT        TTGGAAAATCTATGTTATGGGTC
21         AATTGAGAGGATGGAAGGCT          TTGCTGTCTTGTGATTCGGTC
22         CCCAAAGCAACCATTAATTTTTC       ATGAGGATAGAGATCAAAACGCA
23         CACCTGGTAGGCAGTGAGGAAAT       TTGAAACCCCAAAATATAATGT
24         ATGAATGTGTGAGGGCAGAGGGT       CAAATGAGGAAAAGGGCAAGGT
25         TTAGCGAAGTATTGATGTTGA         TCCCAAGGTTTATCCAGAG
26         AAGCATCATTATCAGTGTCCC         CCTACTGGAGGAATACAAACC
27         CCCCTCCGTCTAGGCTACTGATA       AAACTGAAAACACTGACCTATGGCT
28         GTAGGGAAGAGGTAATGTGGG         AGACACTGAGGGCTCCAA
29         GGCTGTCATCATTTTTCATTT         TTCAGTAACTATTTGGTGGGT
30         GCTTGTGTTTCAATTAGAGAA         CGCAAAGCCATGTTAC
31         GAATGACTCTAACGGTAACGAT        TGGAAGCTATAGGCAAACTATCT
32         CCTGTGGGGATGCTTTTGTAA         AATTTCTGGTTTGGTTTTGGC
33-1       AACTTGTTTCCTTACATTTCA         CCTTGCCTTATTTCCT
33-2       AAGAGGTAGCAGCAATCCATT         CGGCAGGCATCAAGTT
33-3       CCCTCCACCTCCTTCAG             TGGTTTAAGTTGGGTATCTAA
33-4       TTTTAGTGGGAATATGTGGG          AAAAAATTTAAATTAGGGAGATGAT

   ZWINT

1          GTGGATGTGGGGAGCGGCGAACGG      AAGAACTTCCACAGGCGCGCGGTCGAG
2 and 3    GTCTTCAGAAGCCAAGGGGTCG        CCCTGCTGATTTTCCTTTTGGCACGTA
3 and 4    GGCCATTTGTTTCTACAGATAAGCAAG   GTGGTGGTATGTACAAGATGAGAGCGA
5          TCAAAGGAGGAAGCAAAACGGTTTTC    CCAAGGTACACCCAGGGGTCTTGAGTA
6 and 7    CAAATTTACATCTCCAGCAGGTTGTAG   GCAAGAATGCCTCACCCTAGAAC
8          GAGCTCACTGTTATAATTCTGGTTCAC   AGGTAAATGAGAGATGGAACAGG
9a         CTTTAAATAACTTGAGACATTGCTAAC   TAATAAACTTTGAAATTTGGTGAGT
9b         AAATGCATTCTTTCCAAACCTATGTGA   GGTTTGAACACAGGGTGTGCAG

Nallasamy, Mol Vis 2007; 13:229-236 <http://www.molvis.org/molvis/v13/a26/>
©2007 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535