Table 2 of
Yip, Mol Vis 2007;
13:2183-2193.
Table 2. Protein truncation test: primers for cDNA synthesis, first round polymerase chain reaction and second round polymerase chain reaction
Primer NR3 is used for both cDNA synthesis and the amplification of fragment CHM-2.1 in the first round PCR. Both primers CHM-1FT7myc and CHM-2FT7myc have a 5' tail, which has the following sequence: 5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG G AAC AAA AAT TAA TAT CGG AAG AGG ATT TGA AT-3'. This tail has a T7 RNA polymerase promoter sequence at the 5' end (red color), a spacer sequence (7 bases), a consensus Kozak sequence (blue color), and a c-myc-tag sequence at the 3' end (green color). The promoter sequence facilitates the in vitro synthesis of RNA. The Kozak sequence facilitates the initiation of in vitro synthesis of protein. The c-myc-tag produces an N-terminal c-myc peptide (MEQKLISEEDLN) which facilitates the detection of translated polypeptide by anti-c-myc antibody.
Fragments Primers -------------------- ---------------------------------------------- Stage Name Size Name Sequence (5'-3') -------------- ------- ---------- ----------- -------------------------------- cDNA synthesis - 2102 bases NR3 CCTTATAATTGCTGCTGCTTTCTAACA 1st round PCR CHM-1.1 1500 bp NF1 TAATAGTCACATGACACGTTTCCCG NR2 AATGACCCGAACAGCAAAAGTTCCT CHM-2.1 1382 bp NF2 TTAGTATCAAAGCTGCTGTATTCTCG NR3 CCTTATAATTGCTGCTGCTTTCTAACA 2nd round PCR CHM-1.2 1524 bp CHM-1FT7myc Tail-GATACTCTCCCTTCGGAGTTTGAT CHM-2R AGCAAAAGTTCCTGGTTCCTCTGCT CHM-2.2 1426 bp CHM-2FT7myc Tail-TCTCGAGGATTACTAATTGATCTTCTA CHM-3R ATTGCTGCTGCTTTCTAACATTTCTCA |