Table 1 of Vallespin, Mol Vis 2007; 13:2160-2162.


Table 1. Sequences of forward and reverse primers used for the mutation screening of the CEP290 gene

                                                              GenBank
    Gene                 Primer (5'-3')           Size    accession number
-----------------   --------------------------   ------   ----------------
USCS In-Silico      F: CGATCTCCTGAACTCGTGATCCA   259 bp     NC_000012.10
PCR, chr 12         R: GAGTCACATGGGAGTCACAGGGT              GI:89161190
87018928-87019186

Vallespin, Mol Vis 2007; 13:2160-2162 <http://www.molvis.org/molvis/v13/a246/>
©2007 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535