Table 1 of
Preising, Mol Vis 2007;
13:1851-1855.Table 1 of
Preising, Mol Vis 2007;
13:1851-1855.
Table 1. MC1R primers designed for this study
This table contains the primers used to amplify and sequence the MCR1R gene. The gene was amplified in two amplimers (5' part and 3' part). The amplimers overlapped covering codons 111 to 196.
Amplimer Forward Reverse -------- ---------------------- ------------------------- 5' part AGGCCTCCAACGACTCCTTCCT AGAAGACCACGAGGCACAGCAGGAC 3' part GGTGCTGCAGCAGCTGGACAAT ACTTAAAGCCGCGTGCACCG |