Table 2 of
Yuan, Mol Vis 2007;
13:1555-1561.Table 2 of
Yuan, Mol Vis 2007;
13:1555-1561.
Table 2. List of primers used and the PCR product size
For each pair of primers, the amplicon size is indicated in base pairs. F: forward primer; R: reverse primer. In each case, primer pair, (2)F and (2)R, amplifies the most downstream 3' part of the target genomic DNA encompassing the specific exonic sequences. Sequences are given in the 5'-3' direction.
Exon Sequences(5'-3') Amplicon ----- ---------------------- -------- 5(2) F:CGGTGGTGTCTTTGTCAACG 170 5(2) R:AGAGGGCGTTGAGAGTGG 10(2) F:TCAGAGAAGACAGGCCAGC 153 10(2) R:CCCGGAGCAAACAGGTTTAA |