\set{final} \def\Author{Chaurasia} \def\author{chaurasia} \def\vol{12} \def\year{2006} \def\anum{24} \def\pages{215-223} \def\txt_title{Circadian clockwork machinery in neural retina: Evidence for the presence of functional clock components in photoreceptor-enriched chick retinal cell cultures} \def\txt_authors{Shyam S. Chaurasia, Nikita Pozdeyev, Rashidul Haque, Amy Visser, Tamara N. Ivanova, P. Michael Iuvone} \def\rcvd{21 October 2005} \def\accept{27 March 2006} \def\publ{30 March 2006} \def\pdfsize{} \def\PMID{} \include{mvstyle.hsm} \| External links \| Internal defs \article{ \title{Circadian clockwork machinery in neural retina: Evidence for the presence of functional clock components in photoreceptor-enriched chick retinal cell cultures} \authors{\mailto{schaura@emory.edu}{Shyam S. Chaurasia},\sup{1} \mailto{npozdey@emory.edu}{Nikita Pozdeyev},\sup{1} \mailto{rhaque@emory.edu}{Rashidul Haque},\sup{1} \mailto{amy.visser@emory.edu}{Amy Visser},\sup{1} \mailto{biotxi@langate.gsu.edu}{Tamara N. Ivanova},\sup{1} \mailto{miuvone@pharm.emory.edu}{P. Michael Iuvone}\sup{1,2}} \institutions{\sup{1}Department of Pharmacology, \sup{2}Department of Ophthalmology, Emory University School of Medicine, Atlanta, GA} \correspondence{P. Michael Iuvone, PhD, Department of Pharmacology, Emory University School of Medicine, 1510 Clifton Road, Atlanta, GA 30322; Phone: (404) 727-5989; FAX: (404) 727-0365; email: miuvone@pharm.emory.edu} \abstract \abs_purpose{Circadian clocks in retinas regulate a variety of biochemical and physiological processes. Retinal neurons, particularly photoreceptor cells, are thought to contain autonomous circadian clocks that control iodopsin expression, \i{cFos} expression, cAMP levels, and melatonin synthesis. Photoreceptor-enriched cell cultures prepared from chick embryo retina and entrained to a daily light-dark (LD) cycle exhibit circadian rhythms of cAMP levels and the activity of arylalkylamine \i{N}-acetyltransferase (AANAT), a key regulatory enzyme in melatonin synthesis. The present study was conducted to investigate the expression of circadian clockwork machinery comprised of clock genes; a clock-controlled gene, \i{Aanat}; and a clock output, melatonin, in the photoreceptor-enriched cultured retinal cells.} \abs_methods{Photoreceptor-enriched cell cultures were prepared from E6 neural retinas and incubated under 14 h:10 h light-dark cycle (LD) of illumination for 8 days and then transferred to constant (24 h/day) darkness (DD). Cells were collected every 4 h in LD and DD, and RNA was isolated. cDNA was prepared from each sample and transcripts of clock genes and \i{Aanat} were measured using real-time polymerase chain reaction (PCR). Melatonin release into the culture medium was assayed by HPLC with fluorescence detection at intervals of 3 h in LD and DD.} \abs_results{Cultured neural retina cells exposed to a light-dark cycle showed rhythmic expression of clock genes. \i{Bmal1} and \i{Npas2} (also known as \i{Mop4}) peaked late in the day in LD and in DD. \i{Clock} mRNA was high at night in LD, but arrhythmic in DD. \i{Cry1} and \i{Per2} transcripts increased rapidly in the early morning and were low at night. The rhythm of \i{Per2} was reduced in amplitude in constant darkness (DD). Levels of \i{Cry1} and \i{Per2} transcripts were stimulated by light exposure at night. Melatonin release and \i{Aanat} mRNA were low during the day and high at night. Rhythmic expression of clock genes and \i{Aanat} was not observed in cultures not exposed to a LD cycle but treated otherwise identically to cultures described above.} \abs_conclusions{Photoreceptor-enriched cell cultures derived from chick embryo neural retina contain a complete circadian clockwork system that is entrained by the light-dark cycle, and has a core timekeeping mechanism and circadian output in the form of melatonin synthesis.} \introduction \p{Circadian clocks are self-sustaining genetically based molecular machines that impose approximately 24 h rhythmicity on physiology and behavior, synchronizing these functions with the solar day-night cycle [1]. These clocks provide a selective advantage to organisms by allowing them to anticipate temporal changes in their environment. Circadian clocks contain three main components: an input or entrainment mechanism, a self-sustaining timing device, and an output mechanism. The current model for the molecular basis of the timing device in vertebrates consists of interlocking transcriptional-translational feedback loops involving a highly conserved set of "clock genes" [1-3]. These feedback loops consist of positive (CLOCK, BMAL1, and MOP4, also known as NPAS2) and negative components (PER 1 and 2; CRY 1 and 2). The temporal delay between transcription and translation of the clock components and some poorly understood phosphorylation events controlling nuclear import/export and protein degradation result in a daily rhythm in the transcripts and protein products of the clock genes.} \p{The retina is characterized by the presence of autonomous circadian clocks and a photoentrainment mechanism [3-7]. Retinal circadian clocks regulate a variety of cellular, biochemical, and physiological processes, including expression of immediate early genes, activities of the enzymes in signal transduction pathways, rod outer segment disc shedding, phagocytosis by retinal pigment epithelium (RPE), and the release of the neurohormone melatonin [3,8]. Circadian clocks in the retina also play a role in the daily modulation of visual sensitivity and electroretinograph (ERG) responses to anticipate the changes in ambient lighting and to adjust visual sensitivity for the bright conditions of day and the darkness of night [9,10].} \p{Several studies have demonstrated that melatonin is rhythmically synthesized by the retinal photoreceptors, with markedly higher levels at night than during the day, reflecting the actions of light and the circadian clock [4,11-14]. Arylalkylamine \i{N}-acetyltransferase (AANAT; EC 2.3.1.87) has been identified as a key regulatory enzyme in the melatonin synthetic pathway [15]. In chickens, the enzyme is expressed primarily in retinal photoreceptors and the pineal gland [16,17]. The levels of chicken retinal AANAT activity and melatonin biosynthesis exhibit circadian rhythms, peaking at night [11]. Additionally, AANAT activity in chicken retina is under the control of light, which dramatically suppresses enzyme activity and promotes degradation of the enzyme by a proteasomal mechanism [17]. Recently, we reported that photoreceptor-enriched chicken retinal cell cultures, entrained to a daily light-dark (LD) cycle for eight days, exhibit circadian and photic regulation of AANAT activity that recapitulates regulation in vivo (6). It was also shown that cAMP levels are controlled in a circadian fashion, which in turn, regulates the circadian and photic control of AANAT activity [7].} \p{In search of a suitable model system to investigate circadian clock organization in the retina, we have utilized a photoreceptor-enriched chick retinal cell culture preparation that shows rhythms of cGMP-gated channel activity [18], \i{iodopsin} expression [5], levels of cAMP [7], and the activity of AANAT [6]. The purpose of this study was to determine if these cultured cells, entrained to a daily cycle of light and darkness, rhythmically express clock genes. In addition, output from the circadian clock was assessed by determining circadian rhythms of \i{Aanat} mRNA and melatonin release in these cells.} \methods \subsection{Cell preparation and culture} \p{Monolayer cultures of retinal cells were prepared from neural retinas of 6-day-old chicken embryos (E6) as described by Adler [19] with modifications [6,20]. Neural retinas were dissociated in 0.25% trypsin, and cells were seeded at a density of about 3.6x10\sup{6} cells on polyornithine-coated 35 mm Primaria six-well culture plates (Becton Dickinson Labware, Franklin Lakes, NJ) in 3 ml medium 199 containing 20 mM HEPES, linoleic acid-BSA (110 \mu g/ml), 2 mM glutamine, penicillin-streptomycin (100 U/ml) and 10% fetal bovine serum. Cells were maintained at 39.5\pom 0.4 \deg C under a humidified atmosphere of 5% CO\sub{2} in air. Illumination was provided by an 8 W cool white fluorescent lamp (General Electric, Cleveland, OH) and the irradiance at the level of the culture dishes was 30-60 \mu W/cm\sup{2}. Days in vitro (DIV) are numbered successively from the day of dissection (DIV 0). On DIV 1, S-(p-nitrobenzyl)-6-thioinosine (NBTI) was added in a final concentration of 5 \mu M. Medium was replaced on DIV 4 and 7 with medium 199, 1% fetal bovine serum, 1% equine serum, 5 nM insulin-like growth factor-1, 5 \mu M 9-\i{cis}-retinoic acid, and the above given concentrations of HEPES, glutamine, linoleic acid-BSA, NBTI and penicillin-streptomycin. Fertilized eggs and cultured cells were exposed to a daily lighting regime of 14 h light (L) and 10 h dark (D) from day 1 of incubation, with light onset at Zeitgeber time (ZT) 0. DIV9, cells were transferred to constant darkness (DD). All measurements were made on DIV 8-10 at the times indicated in the figures.} \p{To assess the proportion of cells expressing a photoreceptor phenotype in these cultures, cells were fixed on DIV 9 in 3.7% formaldehyde, and were stained with oil red O, which labels lipid droplets [21] that are characteristic of avian cone photoreceptors in vivo and in vitro [22,23], and with DAPI, to label the nuclei of all cells in the cultures. A total of 3,064 cells were counted from randomly selected microscope fields from 12 culture dishes. In this sample, 78\pom 2% of the DAPI labeled cells stained with oil red O. This estimate of the percentage of photoreceptors is consistent with previous estimates made on cultures generated from E6 chick retina and grown at lower density [24,25].} \subsection{RNA isolation and first strand cDNA synthesis} \p{Cells were washed twice with Hanks' Balanced Salt Solution (HBSS) and collected in 150 \mu l of Buffer RLT, and processed for RNA isolation by a silica-based filter-binding RNeasy mini kit (Qiagen Inc., Valencia, CA). Samples were treated with RNase-free DNase I following the manufacturer's instructions (Qiagen Inc.). First strand cDNA synthesis was performed as described [26]. Briefly, total RNA (2 \mu g) was reverse transcribed in the literature a 20 \mu l reaction using oligo-dT primer (Invitrogen, Carlsbad, CA), RNase inhibitor and Superscript III reverse transcriptase (Invitrogen). The reaction proceeded for 1 h at 50 \deg C, followed by 15 min at 72 \deg C to inactivate the enzyme.} \subsection{Quantitative real time PCR} \p{Real time PCR amplification of cDNA was performed with SYBR Green master mix (Bio-Rad, Hercules, CA) in a Bio-Rad iCycler (Bio-Rad) as described in previous reports [26,27]. Briefly, the reaction mixture included 2 \mu l of cDNA, 1X SYBR Green mix, and 300 nM gene specific forward and reverse primers. PCR reaction includes initial denaturation at 95 \deg C for 3 min followed by 45 cycles of denaturation at 95 \deg C for 15 s, annealing at 60 \deg C for 30 s, and extension at 72 \deg C for 30 s. Each sample was assayed in triplicate and normalized to the expression of a housekeeping gene, \i{hypoxanthine phosphoribosyl transferase (Hprt)}. cDNA fragments of \i{Bmal1} (GenBank accession number \genbankdna{AF205219}), \i{Npas2/Mop4} (GenBank accession number \genbankdna{AF396828}), \i{Clock} (GenBank accession number \genbankdna{AF246959}), \i{Cry1} (GenBank accession number \genbankdna{AY034432}), \i{Per2} (GenBank accession number \genbankdna{AF246956}), \i{Hprt} (GenBank accession number \genbankdna{AJ132697}), and \i{Aanat} (GenBank accession number \genbankdna{U46502}) transcripts were generated by PCR, gel purified, quantitated, and used as standards in the real-time PCR assays. The primers used in the experiment for the expression of \i{Aanat} and clock genes (\tabref{1}) were designed using the software PrimerQuest (Integrated DNA Technologies, Coralville, IA) and validated for the single PCR product as verified by melting curve analysis, agarose gel electrophoresis and DNA sequencing. Moreover, each primer set was designed spanning intron-exon borders and/or bracketing one or more introns.} \subsection{Estimation of melatonin} \p{At ZT 0 on day 8 in vitro, medium was replaced with 1 ml of fresh medium using the same formulation described for medium changes on DIV 4 and 7. Thereafter, 1 ml of media was collected from the culture dishes and replaced every 3 h on DIV 8 in LD and on DIV 9 in DD. Levels of melatonin in culture media were determined by reversed-phase high performance liquid chromatography (HPLC). To 100 \mu l of culture media 20 \mu l of 1 N HClO\sub{4} was added to precipitate proteins. After centrifugation at 15,000 g for 10 min, a 100 \mu l aliquot of supernatant was injected into the HPLC system. The separation was performed on an Ultrasphere ODS 250x4.6 mm column, 5 mm (Beckman Coulter, Fullerton, CA) with 40% methanol in water as the mobile phase. Melatonin was detected by fluorescence with excitation and emission wavelengths set at 283 and 352 nm, respectively. External standards of melatonin with concentrations ranging from 50 to 2000 pg/injection were used to build a calibration curve.} \subsection{Statistical analysis} \p{Data are expressed as mean\pom standard error of the mean (SEM) and were analyzed by one-way analysis of variance (ANOVA) followed by Student-Newman-Keul's multiple comparison test.} \results \subsection{Circadian clock components in chicken photoreceptor-enriched cultured retinal cells} \p{Real-time PCR analysis showed robust rhythms in the expression of \i{Bmal1} and \i{Npas2} transcripts in cultured photoreceptor cells. In LD, \i{Bmal1} mRNA levels peak at about ZT 12 (p\lt 0.001) and continue to display circadian rhythms for two days in DD (p\lt 0.001; \figref{1}{A}). The circadian oscillatory pattern of \i{Npas2} mRNA is similar to that of \i{Bmal1} transcript with high levels at ZT 8-12 (p\lt 0.001), which persist in constant darkness (p\lt 0.001; \figref{1}{B}). The timing of the peak levels of \i{Bmal1} and \i{Npas2} is similar to that seen in 2 week posthatch chicken retina in vivo [22]. The expression of \i{Clock} mRNA showed a diurnal rhythm with highest levels at night in LD (p\lt 0.001; \figref{1}{C}). \i{Clock} mRNA levels increased during the first day in DD (p\lt 0.05) and became arrhythmic (\figref{1}{C}).} \p{In LD and DD, levels of \i{Cry1} increased during the subjective day with highest levels from ZT 4-12 (p\lt 0.001); they decreased during the subjective night to show a trough in the late night (\figref{2}{A}). In LD, \i{Per2} mRNA levels showed a large increase after light onset, reaching a peak at about ZT 4, and then declined to a minimum at about ZT 16 (p\lt 0.001; \figref{2}{B}). In DD, a similar, statistically significant pattern was observed (p\lt 0.01), but with greatly reduced amplitude (\figref{2}{B}). Light exposure for 2 h at night (ZT 18) significantly increased the levels of \i{Cry1} and \i{Per2} transcripts (p\lt 0.001; \figref{2}{C,D}). The magnitude of light induction was greater for \i{Per2} than for \i{Cry1}. Induction by a light pulse and persistent rhythms in DD are indicative of both photic and circadian control.} \subsection{Circadian output of the photoreceptor-enriched cell cultures} \p{Cultured photoreceptor cells showed circadian fluctuations of \i{Aanat} mRNA peaking at about ZT 20 in LD (p\lt 0.001). In DD, \i{Aanat} transcript levels continued to be robustly rhythmic (p\lt 0.001; \figref{3}), with broader peaks at night (ZT 12-20).} \p{Melatonin release into the culture medium was significantly higher during the night at ZT 17-20 compared to that seen in the day (p\lt 0.001; \figref{4}), which corresponds to the levels of \i{Aanat} mRNA expression in these cells. In constant darkness, rhythmic melatonin release persisted (p\lt 0.001), but with lower amplitude (\figref{4}).} \subsection{Photoentrainment of circadian gene expression} \p{To determine if the rhythms of clock gene and \i{Aanat} expression are entrained by the light cycle or caused by culture conditions, such as medium exchange, cells were prepared and seeded into culture dishes and then incubated in either darkness or in LD for eight days. All cells were subjected to the same culture conditions and schedule of medium changes, which were performed under dim room light. In cells incubated in LD, robust day-night rhythms of \i{Bmal1}, \i{Npas2}, and \i{Aanat} transcripts were observed (ZT 12 compared to ZT 20, p\lt 0.001; \figref{5}{A}), consistent with previous results (\figref{1}, \figref{3}). In contrast, cells that were not cultured under an LD cycle showed no day-night differences in the levels of these transcripts when sampled at the same two times of the subjective day (with respect to medium changes; \figref{5}{B}), indicating that photoentrainment, rather than culture conditions, sets the circadian oscillations in the photoreceptor cultures.} \discussion \p{In this study, we have demonstrated that photoreceptor-enriched cell cultures derived from neural retina exhibit an autonomous circadian clock that is entrained to the daily LD cycle. They express transcripts encoding several positive and negative clock components, and a clock output in the form of melatonin secretion. The rhythmic expression of circadian clock genes in LD and DD demonstrates the presence of a circadian pacemaker.} \p{The presence of an autonomous circadian clock in the retina of vertebrates was first conclusively demonstrated in cultured eyecups of the African clawed frog \i{Xenopus laevis}, where the activity of the AANAT was shown to be regulated by a circadian clock [28]. Moreover, the circadian rhythm of this enzyme could be phase-shifted by light in vitro, thus demonstrating that the photoreceptor responsible for the entrainment resided within the eyecup. Subsequently, Cahill and Besharse [13] showed that the circadian pacemaker controlling this rhythm was located in photoreceptors. The presence of circadian clocks in the retinas of many vertebrates, including fishes, reptiles, birds, and mammals, has now been firmly established [5,27,29-31].} \p{The avian retina rhythmically expresses several clock genes in vivo. \i{Bmal1} and \i{Npas2} are highly rhythmic in LD and DD, with highest levels during the late day and early night [27]. \i{Clock} mRNA is also expressed in chick retina, but with a low amplitude rhythm [32]. \i{Cry1} and \i{Per2} transcripts peak during the beginning of the subjective day [33,34]. \i{Cry2} mRNA is also expressed in chick retina, but its temporal expression pattern is unknown [35]. The clock in the chicken retina also controls the expression of \i{Aanat} in photoreceptors [16,17]. Multiple cell types in the avian retina may contain functional circadian clocks. There is evidence of circadian rhythms in photoreceptors [4,5,18], cells in the inner nuclear layer [36], and retinal ganglion cells [37].} \p{Cultures of embryonic chick retinal cells have been used extensively in studies of retinal development [19]; regulatory mechanisms involved in retinal melatonin biosynthesis, phototransduction, and receptor-mediated signaling [5,24,38-40]; and photoreceptor retinomotor movements [41,42]. Photoreceptor-enriched cell cultures express circadian rhythms of cAMP level and AANAT activity following entrainment to LD cycle of illumination [6,7]. Light exposure for 2 h at night dramatically decreases cAMP and AANAT activity to the levels observed during the day [6,7]. From earlier studies, we know that cAMP protagonists stimulate \i{Aanat} mRNA and activity in these cells [24,38,39]. Thus, circadian control of cAMP may play an important role in generating circadian rhythms of \i{Aanat} transcription and melatonin synthesis. Although the previous studies mentioned above suggest the possibility that retinal photoreceptors contain a circadian clock that responds to light, these data are not sufficient to identify the nature of the circadian pacemaker in retinal photoreceptors. Moreover, these studies examined the regulation of clock-controlled genes; none of them showed the actual clock components.} \p{In the present study, we found that cultured chick retinal cells rhythmically express \i{Aanat} and clock genes known to be essential components of the core molecular clockwork in the mammalian brain. \i{Aanat} mRNA levels show robust circadian regulation, with high levels at night in LD and DD. \i{Bmal1} and \i{Npas2} are rhythmically transcribed with high levels at about ZT 12, as seen in vivo [27], approximately 8 h prior to the peak of \i{Aanat} mRNA rhythm. \i{Clock} transcript levels peak later at night in LD, but were arrhythmic in constant darkness. \i{Cry1} and \i{Per2} mRNAs showed highest levels during the day, about 8-12 h out of phase with the \i{Aanat} transcript rhythm. The chicken \i{Aanat} promoter contains a circadian E-box enhancer element where the circadian clock components BMAL1 and CLOCK/NPAS2 bind and enhance transcription [43]. The temporal expression patterns of the positive and negative clock components are consistent with a model in which BMAL1/CLOCK or BMAL1/NPAS2 drive circadian \i{Aanat} expression at night, with expression being suppressed during the day by PER and CRY, which inhibit E-box driven transcription by BMAL1/CLOCK-NPAS2. This E-box mediated control, coupled with the circadian rhythm of cAMP, may cooperatively generate the circadian rhythms of \i{Aanat} transcription and melatonin synthesis.} \p{For the most part, the rhythmic expression of clock genes in retinal cell culture recapitulates the temporal expression patterns seen in the chicken retina in vivo. One notable exception is \i{Cry1}, which damps quickly in DD in vivo [34], but not in vitro. However, the in vivo observation of \i{Cry1} mRNA arrhythmicity in DD was made on whole retina and \i{Cry1} is expressed in all retinal layers, including the photoreceptor layer [34]. Thus, \i{Cry1} rhythmicity in photoreceptors in DD may have been masked by damping in other retinal cell types.} \p{In the present study, we observed circadian rhythms of melatonin release in LD and DD. However, the rhythm in DD had greatly reduced amplitude compared to that in LD. This may have resulted from cellular damage caused by repeated (every 3 h) medium changes, or may reflect the influence of post-translational photic control of AANAT in LD. The rhythms of \i{Aanat} mRNA remained relatively robust in DD in the cell cultures, as in vivo [34]. However, AANAT activity rhythms in vivo and in vitro show reduced amplitude in DD [6,17]. The reduced amplitude in AANAT activity appears to reflect the absence of photic control mechanisms in DD. Light promotes the degradation of AANAT protein in chick retina by proteasomal proteolysis [17]. Thus, in LD, the high amplitude of AANAT activity rhythms reflects a combination of the circadian clock-control of \i{Aanat} transcription and the light-mediated degradation of AANAT protein during the day; the latter effect is lost in DD.} \p{Previous studies have shown that some cultured cell types and peripheral tissues can be induced to rhythmically express clock genes by serum shock or medium exchange [44,45]. Thus, an important consideration in the present study is whether the rhythms of clock gene expression and \i{Aanat} expression are a function of light-dark cycles or culture conditions, such as medium exchange. Several lines of evidence indicate that the rhythms are photoentrained. In the present study, rhythms of \i{Clock} mRNA were observed in LD but not in DD. In LD, \i{Per2} levels were rapidly induced after light onset at dawn, resulting in a high amplitude rhythm; in DD, the large increase in \i{Per2} expression was not observed at subjective dawn but a lower amplitude circadian rhythm of expression persisted. In addition, \i{Per2} mRNA levels were strongly induced by light exposure at night. The induction of \i{Per2} by light probably plays a key role in the photo-entrainment of circadian clocks in the retinal cell cultures, as in other circadian clock systems [33,46-49]. More definitively, retinal cell cultures never exposed to LD cycles, but subjected to the same culture conditions and media changes as cultures exposed to LD, failed to display day-night changes of clock gene and \i{Aanat} transcript expression.} \p{The light sensitivity of clock gene expression and the circadian control of \i{Aanat} in retinal cell cultures suggest that circadian clocks are expressed by the photoreceptor cells in these cultures. However, the cultures are not pure, with only about 80% of the cells expressing a photoreceptor phenotype. Thus, we cannot exclude the possibility that nonphotoreceptor cells in the cultures express the clocks that regulate circadian \i{Aanat} expression in photoreceptors via neurohumoral communication or gap junctions. With respect to the latter possibility, it should be noted that gap junction uncoupling agents disrupt circadian expression of \i{Aanat} and \i{iodopsin} in explant cultures of chick retina [50].} \p{In conclusion, photoreceptor-enriched retinal cell cultures express photoentrained circadian clocks and clock outputs. These cell cultures may serve as an excellent model to facilitate the biochemical and genetic dissection of the retinal circadian clockwork.} \acknowledgements \p{This work was supported by grant EY04864 from the National Institutes of Health. Preliminary reports of some of these data were presented at the 2005 meeting of the Association for Research in Vision and Ophthalmology (Ft. Lauderdale, FL) and the Xth Congress of the European Pineal and Biological Rhythm Society (Frankfurt, Germany; 2005).} \references \p{1. Hastings MH, Reddy AB, Maywood ES. A clockwork web: circadian timing in brain and periphery, in health and disease. Nat Rev Neurosci 2003; 4:649-61. \pubmed{12894240}} \p{2. Reppert SM, Weaver DR. Coordination of circadian timing in mammals. Nature 2002; 418:935-41. \pubmed{12198538}} \p{3. Iuvone PM, Tosini G, Pozdeyev N, Haque R, Klein DC, Chaurasia SS. Circadian clocks, clock networks, arylalkylamine N-acetyltransferase, and melatonin in the retina. Prog Retin Eye Res 2005; 24:433-56. \pubmed{15845344}} \p{4. Thomas KB, Tigges M, Iuvone PM. Melatonin synthesis and circadian tryptophan hydroxylase activity in chicken retina following destruction of serotonin immunoreactive amacrine and bipolar cells by kainic acid. Brain Res 1993; 601:303-7. \pubmed{8431777}} \p{5. Pierce ME, Sheshberadaran H, Zhang Z, Fox LE, Applebury ML, Takahashi JS. Circadian regulation of iodopsin gene expression in embryonic photoreceptors in retinal cell culture. Neuron 1993; 10:579-84. \pubmed{8476610}} \p{6. Ivanova TN, Iuvone PM. Melatonin synthesis in retina: circadian regulation of arylalkylamine N-acetyltransferase activity in cultured photoreceptor cells of embryonic chicken retina. Brain Res 2003; 973:56-63. \pubmed{12729953}} \p{7. Ivanova TN, Iuvone PM. Circadian rhythm and photic control of cAMP level in chick retinal cell cultures: a mechanism for coupling the circadian oscillator to the melatonin-synthesizing enzyme, arylalkylamine N-acetyltransferase, in photoreceptor cells. Brain Res 2003; 991:96-103. \pubmed{14575881}} \p{8. Tosini G, Fukuhara C. The mammalian retina as a clock. Cell Tissue Res 2002; 309:119-26. \pubmed{12111542}} \p{9. Barlow R. Circadian and efferent modulation of visual sensitivity. Prog Brain Res 2001; 131:487-503. \pubmed{11420965}} \p{10. Solessio E, Scheraga D, Engbretson GA, Knox BE, Barlow RB. Circadian modulation of temporal properties of the rod pathway in larval Xenopus. J Neurophysiol 2004; 92:2672-84. \pubmed{15486422}} \p{11. Hamm HE, Menaker M. Retinal rhythms in chicks: circadian variation in melantonin and serotonin N-acetyltransferase activity. Proc Natl Acad Sci U S A 1980; 77:4998-5002. \pubmed{6933543}} \p{12. Zawilska JB, Iuvone PM. Melatonin synthesis in chicken retina: effect of kainic acid-induced lesions on the diurnal rhythm and D2-dopamine receptor-mediated regulation of serotonin N-acetyltransferase activity. Neurosci Lett 1992; 135:71-4. \pubmed{1347416}} \p{13. Cahill GM, Besharse JC. Circadian clock functions localized in xenopus retinal photoreceptors. Neuron 1993; 10:573-7. \pubmed{8476609}} \p{14. Sakamoto K, Liu C, Tosini G. Circadian rhythms in the retina of rats with photoreceptor degeneration. J Neurochem 2004; 90:1019-24. \pubmed{15287909}} \p{15. Klein DC, Coon SL, Roseboom PH, Weller JL, Bernard M, Gastel JA, Zatz M, Iuvone PM, Rodriguez IR, Begay V, Falcon J, Cahill GM, Cassone VM, Baler R. The melatonin rhythm-generating enzyme: molecular regulation of serotonin N-acetyltransferase in the pineal gland. Recent Prog Horm Res 1997; 52:307-58. \pubmed{9238858}} \p{16. Bernard M, Iuvone PM, Cassone VM, Roseboom PH, Coon SL, Klein DC. Avian melatonin synthesis: photic and circadian regulation of serotonin N-acetyltransferase mRNA in the chicken pineal gland and retina. J Neurochem 1997; 68:213-24. \pubmed{8978728}} \p{17. Iuvone PM, Brown AD, Haque R, Weller J, Zawilska JB, Chaurasia SS, Ma M, Klein DC. Retinal melatonin production: role of proteasomal proteolysis in circadian and photic control of arylalkylamine N-acetyltransferase. Invest Ophthalmol Vis Sci 2002; 43:564-72. \pubmed{11818405}} \p{18. Ko GY, Ko ML, Dryer SE. Circadian regulation of cGMP-gated cationic channels of chick retinal cones. Erk MAP Kinase and Ca2+/calmodulin-dependent protein kinase II. Neuron 2001; 29:255-66. \pubmed{11182096}} \p{19. Adler R. Tropic interactions in retinal development and in retinal degenerations. In vivo and in vitro studies. In: Adler R, Farber D, editors. The Retina: a model for cell biology studies. Orland: Academic Press; 1986. p. 111-50.} \p{20. Haque R, Alonso-Gomez AL, Chaurasia SS, Iuvone PM. Diurnal regulation of arylalkylamine N-acetyltransferase activity in chicken retinal cells in vitro: analysis of culture conditions. Mol Vis 2003; 9:52-9 \mvref{9}{9}. \pubmed{12629487}} \p{21. Laughton C. Measurement of the specific lipid content of attached cells in microtiter cultures. Anal Biochem 1986; 156:307-14. \pubmed{2429579}} \p{22. Adler R, Lindsey JD, Elsner CL. Expression of cone-like properties by chick embryo neural retina cells in glial-free monolayer cultures. J Cell Biol 1984; 99:1173-8. \pubmed{6470040}} \p{23. Partridge JC. The visual ecology of avian cone oil droplets. J Comp Physiol [A] 1989; 165:415-26. \doi{10.1007/BF00619360}} \p{24. Iuvone PM, Avendano G, Butler BJ, Adler R. Cyclic AMP-dependent induction of serotonin N-acetyltransferase activity in photoreceptor-enriched chick retinal cell cultures: characterization and inhibition by dopamine. J Neurochem 1990; 55:673-82. \pubmed{1695244}} \p{25. Repka A, Adler R. Differentiation of retinal precursor cells born in vitro. Dev Biol 1992; 153:242-9. \pubmed{1397681}} \p{26. Chaurasia SS, Rollag MD, Jiang G, Hayes WP, Haque R, Natesan A, Zatz M, Tosini G, Liu C, Korf HW, Iuvone PM, Provencio I. Molecular cloning, localization and circadian expression of chicken melanopsin (Opn4): differential regulation of expression in pineal and retinal cell types. J Neurochem 2005; 92:158-70. \pubmed{15606905}} \p{27. Chong NW, Chaurasia SS, Haque R, Klein DC, Iuvone PM. Temporal-spatial characterization of chicken clock genes: circadian expression in retina, pineal gland, and peripheral tissues. J Neurochem 2003; 85:851-60. \pubmed{12716417}} \p{28. Besharse JC, Iuvone PM. Circadian clock in Xenopus eye controlling retinal serotonin N-acetyltransferase. Nature 1983; 305:133-5. \pubmed{6888555}} \p{29. Tosini G, Menaker M. Circadian rhythms in cultured mammalian retina. Science 1996; 272:419-21. \pubmed{8602533}} \p{30. Tosini G, Menaker M. Multioscillatory circadian organization in a vertebrate, iguana iguana. J Neurosci 1998; 18:1105-14. \pubmed{9437030}} \p{31. Zhang Y, Coleman JE, Fuchs GE, Semple-Rowland SL. Circadian oscillator function in embryonic retina and retinal explant cultures. Brain Res Mol Brain Res 2003; 114:9-19. \pubmed{12782388}} \p{32. Larkin P, Baehr W, Semple-Rowland SL. Circadian regulation of iodopsin and clock is altered in the retinal degeneration chicken retina. Brain Res Mol Brain Res 1999; 70:253-63. \pubmed{10407173}} \p{33. Yoshimura T, Suzuki Y, Makino E, Suzuki T, Kuroiwa A, Matsuda Y, Namikawa T, Ebihara S. Molecular analysis of avian circadian clock genes. Brain Res Mol Brain Res 2000; 78:207-15. \pubmed{10891604}} \p{34. Haque R, Chaurasia SS, Wessel JH 3rd, Iuvone PM. Dual regulation of cryptochrome 1 mRNA expression in chicken retina by light and circadian oscillators. Neuroreport 2002; 13:2247-51. \pubmed{12488805}} \p{35. Bailey MJ, Chong NW, Xiong J, Cassone VM. Chickens' Cry2: molecular analysis of an avian cryptochrome in retinal and pineal photoreceptors. FEBS Lett 2002; 513:169-74. \pubmed{11904144}} \p{36. Garbarino-Pico E, Valdez DJ, Contin MA, Pasquare SJ, Castagnet PI, Giusto NM, Caputto BL, Guido ME. Rhythms of glycerophospholipid synthesis in retinal inner nuclear layer cells. Neurochem Int 2005; 47:260-70. \pubmed{15979208}} \p{37. Garbarino-Pico E, Carpentieri AR, Contin MA, Sarmiento MI, Brocco MA, Panzetta P, Rosenstein RE, Caputto BL, Guido ME. Retinal ganglion cells are autonomous circadian oscillators synthesizing N-acetylserotonin during the day. J Biol Chem 2004; 279:51172-81. \pubmed{15448149}} \p{38. Gan J, Alonso-Gomez AL, Avendano G, Johnson B, Iuvone PM. Melatonin biosynthesis in photoreceptor-enriched chick retinal cell cultures: role of cyclic AMP in the K(+)-evoked, Ca(2+)-dependent induction of serotonin N-acetyltransferase activity. Neurochem Int 1995; 27:147-55. \pubmed{7580870}} \p{39. Iuvone PM, Gan J. Functional interaction of melatonin receptors and D1 dopamine receptors in cultured chick retinal neurons. J Neurosci 1995; 15:2179-85. \pubmed{7534345}} \p{40. Cailleau V, Bernard M, Morin F, Guerlotte J, Voisin P. Differential regulation of melatonin synthesis genes and phototransduction genes in embryonic chicken retina and cultured retinal precursor cells. Mol Vis 2005; 11:472-81 \mvref{11}{55}. \pubmed{16030498}} \p{41. Stenkamp DL, Adler R. Photoreceptor differentiation of isolated retinal precursor cells includes the capacity for photomechanical responses. Proc Natl Acad Sci U S A 1993; 90:1982-6. \pubmed{8446618}} \p{42. Stenkamp DL, Iuvone PM, Adler R. Photomechanical movements of cultured embryonic photoreceptors: regulation by exogenous neuromodulators and by a regulable source of endogenous dopamine. J Neurosci 1994; 14:3083-96. \pubmed{7910204}} \p{43. Chong NW, Bernard M, Klein DC. Characterization of the chicken serotonin N-acetyltransferase gene. Activation via clock gene heterodimer/E box interaction. J Biol Chem 2000; 275:32991-8. \pubmed{10931848}} \p{44. Balsalobre A, Damiola F, Schibler U. A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell 1998; 93:929-37. \pubmed{9635423}} \p{45. Yamazaki S, Numano R, Abe M, Hida A, Takahashi R, Ueda M, Block GD, Sakaki Y, Menaker M, Tei H. Resetting central and peripheral circadian oscillators in transgenic rats. Science 2000; 288:682-5. \pubmed{10784453}} \p{46. Shearman LP, Zylka MJ, Weaver DR, Kolakowski LF Jr, Reppert SM. Two period homologs: circadian expression and photic regulation in the suprachiasmatic nuclei. Neuron 1997; 19:1261-9. \pubmed{9427249}} \p{47. Albrecht U, Sun ZS, Eichele G, Lee CC. A differential response of two putative mammalian circadian regulators, mper1 and mper2, to light. Cell 1997; 91:1055-64. \pubmed{9428527}} \p{48. Field MD, Maywood ES, O'Brien JA, Weaver DR, Reppert SM, Hastings MH. Analysis of clock proteins in mouse SCN demonstrates phylogenetic divergence of the circadian clockwork and resetting mechanisms. Neuron 2000; 25:437-47. \pubmed{10719897}} \p{49. Steenhard BM, Besharse JC. Phase shifting the retinal circadian clock: xPer2 mRNA induction by light and dopamine. J Neurosci 2000; 20:8572-7. \pubmed{11102460}} \p{50. Zhang Y, Semple-Rowland SL. Rhythmic expression of clock-controlled genes in retinal photoreceptors is sensitive to 18-beta-glycyrrhetnic acid and 18-alpha-glycyrrhetnic acid-3-hemisuccinate. Brain Res Mol Brain Res 2005; 135:30-9. \pubmed{15857666}} \endreferences } \beginfigures \figfile{1}{ \figtitle{1}{Temporal expression of positive modulators of the circadian clockwork system} \p{Relative mRNA levels of \i{Bmal1} (\panel{A}) and \i{Npas2} (\panel{B}) in photoreceptor-enriched retinal cell cultures collected at the indicated zeitgeber times (ZT) in light-dark (LD) and dark-dark (DD). Each data point represents clock gene transcripts normalized to \i{Hprt} mRNA and expressed relative to the lowest values in LD. The open horizontal bar at the X-axis represents times of light exposure; the black bars represent times of darkness. Analysis of variance (ANOVA) indicated significant rhythms of \i{Bmal1} and \i{Npas2} transcripts in LD and DD (p\lt 0.001), with highest levels in the late day and early night; n=4-6 cultures per time. \panel{C}: \i{Clock} mRNA showed significantly higher values during the night (ZT 16) than during the day in LD (p\lt 0.001); transcript levels increased on the first day of DD (ZT 0 compared to ZT 20; p\lt 0.05) but there were no significant rhythms on DD1 or DD2. There were 5-6 cultures for each time.} \ctr{\gifimage{1}{487}{1374}{68}} } \figfile{2}{ \figtitle{2}{Temporal expression of negative modulators of the circadian clockwork system} \p{Circadian profiles of \i{Cry1} (\panel{A}) and \i{Per2} (\panel{B}) transcripts in the photoreceptor-enriched retinal cell cultures collected at the indicated zeitgeber time (ZT) in light-dark (LD) and dark-dark (DD). Each data point represents clock gene transcripts normalized to \i{Hprt} mRNA, expressed relative to the lowest values in LD. ANOVA indicated significant differences (p\lt 0.001) with high levels of both transcripts in the first half of the day in LD and DD; There were 6 cultures for each time. Acute light exposure at night induces \i{Cry1} (\panel{C}) and \i{Per2} (\panel{D}) mRNA expression. On day in vitro 9, cells were kept in constant darkness until ZT 18, when one group of cells was collected. Another group of cells remained in darkness for an additional 2 h (solid symbol), while a third group of cells was exposed to light for 2 h prior to cell harvesting (open symbol). Exposure to light significantly increased \i{Cry1} and \i{Per2} transcript levels (p\lt 0.001; n=5-6 culture dishes per group).} \ctr{\gifimage{2}{700}{679}{57}} } \figfile{3}{ \figtitle{3}{Circadian profile of \i{Aanat} transcript level} \p{Each data point represents \i{Aanat} transcript normalized to \i{Hprt} mRNA, expressed relative to the lowest values in light-dark (LD). ANOVA indicated a significant rhythm (p\lt 0.001) for \i{Aanat} mRNA with high values at night in LD and dark-dark (DD), compared to values in day. There were 4 cultures for each time.} \ctr{\gifimage{3}{400}{372}{20}} } \figfile{4}{ \figtitle{4}{Circadian profile of melatonin release} \p{For melatonin estimation, on day 8 starting at zeitgeber times (ZT) 0, media (1 ml) was collected and replaced simultaneously at the times indicated in the figure. Analysis of variance indicated significant differences between the day and night values of melatonin content (p\lt 0.001) in light-dark (n=5-6) and dark-dark (n=4-6) with concentrations high at night and low during the day.} \ctr{\gifimage{4}{380}{341}{14}} } \figfile{5}{ \figtitle{5}{Photoentrainment of clock gene and \i{Aanat} transcript rhythms} \p{Cell cultures were prepared as described in Methods culture dishes from the same batch of cells were divided into two groups: one kept in incubators without illumination and the other in incubators with a daily light-dark (LD) cycle. Other than exposure to LD, the culture conditions and schedule of medium changes were identical for all cultures. Cultures were sampled on day in vitro (DIV) 8 at ZT 12 and ZT 20 for LD cultures and on DIV 8 at the same times of day for cultures kept in the incubators without illumination. Relative levels of \i{Bmal1}, \i{Npas2}, and \i{Aanat} transcripts were measured. \panel{A}: Cells cultured under a daily cycle of light and darkness from DIV 0-8 displayed significant differences between zeitgeber times (ZT) 12 and ZT 20 for all three transcripts, with \i{Bmal1} and \i{Npas2} higher at ZT 12 and \i{Aanat} higher at ZT 20 (asterisk indicates p\lt 0.01; n=6). \panel{B}: Cells incubated without a daily cycle of illumination, but treated identically otherwise, displayed no significant difference between the two times of day for any of the transcripts measured; n=5-6.} \ctr{\gifimage{5}{800}{393}{27}} } \begintables \tabfile{1}{ \tabtitle{1}{Primers} \p{Real-time PCR primers were designed using PrimerQuest (Integrated DNA Technologies, Caraville, IA) on the indicated GenBank sequences. Each primer pair yielded a single product, as determined by agarose gel electrophoresis, melt curve analysis, and DNA sequencing.} \box{\pre{ Primer Accesssion name Sequence number ------ --------------------------- ---------- Bmal1 F: TGAGGAGTCGCTGGTTCAGTTTCA \genbankdna{AF205219} R: ACGCTGTCCATGCTATGTGGAGAA NPAS2 F: CCAGGGCAAATTGCATCTCCACAA \genbankdna{AF396828} R: AGGATGTGGGCATCATAGGCTGAA Clock F: ACGGTCAAGGACTGCAGATGTTCT \genbankdna{AF246959} R: CTGCAAAGGCTGTTGCTGGATCAT Per2 F: TGGTCACCGTCAGACACTTCACAA \genbankdna{AF246956} R: TTTCCCGAGTCTGGCAGCTGATTA Cry1 F: AGAGAGTGTCCAGAAGGCTGCAAA \genbankdna{AY034432} R: ACTGTTGCAAGAAGACCCAGTCCT Aanat F: ACAGGCACCTTTACAGCACGAGA \genbankdna{U46502} R: CTGCTTCACGACAAACCAAGGCAT }} }