Table 2 of
Metlapally, Mol Vis 2006;
12:725-734.Table 2 of
Metlapally, Mol Vis 2006;
12:725-734.
Table 2.
Oligonucleotide primer sequences and PCR conditions for α-integrin subunits. Primers were designed to the published human sequences in areas of high inter-species homology. Primers for α1- and α2-integrins were taken from Jobling et al. [30] and are tree shrew specific. The optimized PCR conditions are presented in the table with most amplifications using a 40 cycle protocol, except for the α4-, α6-, α7-, and α8-integrin subunits, where a 45 cycle protocol was used.
PCR conditions
-------------------
Oligonucleotide primers (5'-3') Annealing
-------------------------------------------- Size temperature MgCl2
Subunit Forward Reverse (bp) (°C) (mM)
------- --------------------- -------------------- ---- ----------- -----
α1 aatgagcctggagcctatca tatacacggctcctccgtga 198 61 1.5
α2 actttgttgctggtgctcct caagagcacatcggtaatgg 179 58 1.5
α3 aagccaagtctgagact gtagtattggtcccgagtct 657 55 1.5
α4 agcaccatcagagaggaagg gcagaatcagaccgaaaagc 383 55 2
α5 atcagagcaagagccggata ttagtgtcccggagatgagg 388 55 1.5
α6 ggccttatgaagttggtgga tgccttgctggttcatgtag 375 60 5
α7 gcatcaagagcttcggctac acagactcggtcatgctgg 410 62 5
α8 cgcaggtggaaataagagg tctctggaggaaggtgtgg 530 62 2
α9 agaggaggagagggaactgc cccagacaggtggcttgtat 436 58 1.5
α10 atggctccaacagcatctacc aggaaagagctgggatctcg 439 58 4
α11 gctccaacagcatctaccc ggtcactggcgatgtatttg 459 58 1.5
αv tgctgatacaacaggcttgc tccatctctgactgctggtg 420 58 1.5
|