Table 1 of
Metlapally, Mol Vis 2006;
12:725-734.Table 1 of
Metlapally, Mol Vis 2006;
12:725-734.
Table 1.
Oligonucleotide primer sequences and PCR conditions for β-integrin subunits. Primers were designed to the published human sequences in areas of high inter-species homology. The primer sequence for the β1-integrin subunit was taken from Jobling et al. [30] and is tree shrew specific. The optimized PCR conditions are presented in the table with most subunit amplifications using a 40 cycle protocol, except for the β2 and β5-integrin subunits, where a 35 cycle protocol was used.
PCR conditions
-------------------
Oligonucleotide primers (5'-3') Annealing
--------------------------------------------------- Size temperature MgCl2
Subunit Forward Reverse (bp) (°C) (mM)
------- ------------------------ ------------------------ ---- ----------- -----
β1 gtggaggaaatggtgtttgc gtctgcccttggaacttgg 184 55 1.5
β2 caagctggctgaaaacaaca actgctcctggatgcactct 347 58 3
β3 agatgcgaaagctcaccagt ccgtcattaggctggacaat 391 55 3
β4 gccttcactttgagcactcc ctgctgtactcgctttgcag 383 55 1.5
β5 agcagcacccatgtcttgc gaagttgctggtgagcttcc 276 60 4
β6 gactccggaaacattctcca ctgacagtcgcagttgcatt 306 58 5
β7 agcaatggcctctacagtcgcagc gcttggagagaaacccagaaagtc 392 60 1.5
β8 tccatgtgctgtctttgacc tgtcatcaccagcagcaatc 179 58 4
|