Table 2 of
Inagaki, Mol Vis 2006;
12:673-680.
Table 2.
Sequences of primary probes and Invader oligonucleotides used in assays. Three polymorphisms were detected among all participants. Genotyping of the polymorphisms was performed by the Invader assay using the probes listed.
Nucleotide Polymorphism change Target Probe Probe Sequence --------------- ---------- --------- ------- ------- ------------------------- ADRB1 Arg389Gly C to G Antisense Wild C probe Flap1-CGACTGCTCTGCTG Mutant G probe Flap2-GGACTGCTCTGCTG Invader Invader CCCGACTTCCGCAAGGCCTTCCAGT ADRB2 Arg16Gly A to G Sense Wild A probe Flap1-TATTGGGTGCCAGCA Mutant G probe Flap2-CATTGGGTGCCAGC Invader Invader TCGTGGTCCGGCGCATGGCTTCA ADRB2 Gln27Glu C to G Antisense Wild C probe Flap1-CAAAGGGACGAGGTGT Mutant G probe Flap2-GAAAGGGACGAGGTGT Invader Invader GCCGGACCACGACGTCACGCAGT |