Table 1 of
Layton, Mol Vis 2006;
12:43-54.
Table 1. Sequence of primers used for PCR
Primers were designed online using Primer3 to span an intron, thereby eliminating genomic contamination. Parameters were set to minimize self complementarity and maximize PCR efficiency by checking oligonucleotides for possible formation of primer-dimers, primer cross-dimers, and hairpins. BLASTn (version 2.0) was used to ensure 100% specificity of primers to the target. PCRs were optimized for annealing temperature and Mg2+ concentration. Analysis of gels revealed no primer-dimer formation.
Product Annealing Accession mRNA Primer sequences (5'-3') size temp (°C) Cycles number ----------- ------------------------- ------- --------- ------ --------- Cyclophilin TGGTCAACCCCACCGTGTTCTTCG 314 bp 52 26 M19533 TCCAGCATTTGCCATGGACAAGA FGF-2 GCCTTCCCACCCGGCCACTTCAAGG 179 bp 55 27 M22427 GCACACACTCCCTTGATGGACACAA GFAP ATTCCGCGCCTCTCCCTGTCTC 437 bp 55 27 U03700 GCTTCATCCGCCTCCTGTCTGT |