Table 1 of
Roberts, Mol Vis 2006;
12:177-183.Table 1 of
Roberts, Mol Vis 2006;
12:177-183.
Table 1. Primers and amplification conditions
The table indicates polymerase chain reaction conditions and 5'-3' primer sequences for three overlapping fragments spanning the RP1 hotspot region.
Gene Primer (5'-3') Amount Additive Cycles
----- ---------------------------- ------- ----------- ------
4F F: tgctcagtgtggtttaacaaaac 25 pmol 1% glycerol 30
R: ctatggaaattcttggaaatcg
4G F: ggaagacctccagaaaagtgatac 20 pmol 1% glycerol 35
R: cattcctctcaaatacccagatg
4H F: ccaaagatttttatgcaccg 20 pmol - 30
R: caatttaccacactcgtttcatttc
|