Table 2 of
Nickerson, Mol Vis 2006;
12:1565-1585.
Table 2. Primer sets for RT-PCR and for the construction of in situ probes
These primers were used the reverse transcriptase-coupled PCR experiments. Other primers were used in the construction of probes for in situ hybridization. Primer3 [69] was used toredict suitable primers. Tm represents the melting temperature.
A. Primers for RT-PCR for Gene 1-specific mRNA in situ probe Expected product size Primer ID Sequence (5'-3') Tm (bp) --------- ------------------------ ------ -------------- gn1fwd AGGAGGATTTGGCGGGAAAA 65.02 1529 gn1rev AACTGCCTGATTGGGAATCGAA 65.05 B. Primers for RT-PCR for Gene 2-specific mRNA in situ probe Expected product size Primer ID Sequence (5'-3') Tm (bp) --------- ------------------------ ------ --------------- F3 gatgttcatcgcgctcatca 63.32 532 R4 gcagtgtctgaatggctgat 58.83 C. Primers for RT-PCR spanning the intergenic region between Gene 1 and Gene 2 Expected product size Primer ID Sequence (5'-3') Tm (bp) --------- ------------------------ ------ -------------- F1 ttacgactcttccagatgtgcttg 55.2 1098 R3 ggtttgccaactgagtctgcttc 56.8 |