Table 1 of
Zhang, Mol Vis 2006;
12:937-948.
Table 1. Primer sequences
A3U represents primer to detect the upper part of the encoding sequence of A3 adenosine receptor; A3L represents primer to detect the lower part of the encoding sequence of A3 adenosine receptor; A3Q represents primer for the real-time PCR to detect A3 adenosine receptor message, while GAPDH represents the control sequences used for real-time PCR reactions.
Length Gene Forward (5'-3') Reverse (5'-3') Position (bp) Ref. ----- ---------------------- ---------------------- -------- ------ ---- A3-AB GGTCTACGATCCTGTCAAGGAC AGTCCCACCAGAAAGGACACTA 109-749 641 [31] A3-CD CATGTCCTG TGTGCTTCTG GGCTCTTTATCTGTCATGGT 576-1299 726 A3Q GGTCCACTGGCCCAT ACACA CGTAGGTGATTTGCAACCACA 245-367 123 [32] GAPDH CCATGGAGAAGGCTGGGG CAAAGTTGTCATGGATGACC [31] |