Table 1 of
Churchill, Mol Vis 2005;
11:66-70.Table 1 of
Churchill, Mol Vis 2005;
11:66-70.
Table 1. Details of CYP1B1 primers and PCR conditions
Six overlapping primer sets were used to amplify the coding region of the CYP1B1 gene prior to heteroduplex analysis. DNA sequence variations were found in Fragments 1A, 3A and 3B.
Fragment Mg Conc Annealing
Primer Sequence (5'-3') size (bp) (mM) Temp (°C)
------ ----------------------------- --------- ------- ---------
1A F: tcttcggccatttctccag 440 1.5 52
R: tcgccattcagcaccactat
1B F: acggcgaagttttccagat 451 1.5 52
R: gaactcttcgttgtggctga
2A F: actactcggagcactggaa 482 1.5 52
R: taaaggcgtccatcatgtcg
2B F: gcgaattcgagcagctcaa 413 1.5 58
R: taccgacgcgatcttggtt
3A F: tcccagaaatattaatttagtcactg 459 1.5 60
R: cttgttgatgaggccatcc
3B F: caaccagtggtctgtgaatc 521 1.0 58
R: tatggagcacacctcacctg
|