Table 1 of
Jablonski, Mol Vis 2005;
11:569-581.
Table 1. Primers for PCR amplification of the candidate gene Rs1h
Listed in the table are the sequences for the primers used to amplify the mouse Rs1h gene from genomic or cDNA, the DNA melting temperature (Tm), and the predicted fragment size of the PCR product. cDNA was used as a template with primers pairs Rs1h-3L/Rs1h-4R and Rs1h-L/Rs1h-R. Genomic DNA was used as a template with primer pairs Rs1h-5UTR-L/Rs1h-Intron1-R and Rs1h1iL/Rs1h2iR.
Fragment Designation Sequence (5'-3') Tm (°C) size (bp) -------------- ------------------------------- ------- --------- Rs1h-3L TGGCTATGAAGCCACATTGGG 63 °C 679 Rs1h-4R CCCAAAGCTCTCCCTGCAAGTG Rs1h-L CACTTAGATCTTGCTGTGACCAAGGAC 65 °C 190 Rs1h-R CAGACCACAGAGCATTGGCTCC Rs1h-5UTR-L CTTAATCTCTATGGCATTGTTTTCATTTTGC 66 °C 326 Rs1h-Intron1-R CTCATGCCCACACCCAACACC Rs1h1iL TGCCCTGCTCCTATGCCAGC 46 °C 244 Rs1h2iR TACCCCTCAGCACTCTTCCCC |