Table 1 of
Chaki, Mol Vis 2005;
11:531-534.Table 1 of
Chaki, Mol Vis 2005;
11:531-534.
Table 1. Primers and PCR conditions for amplification of TYR exons 1, 2, and 3
The 490 bp fragment amplicon of Tyr1bF and Tyr1bR was digested with the NlaIV (New England Biolabs, Beverly, MA) to generate 3 smaller fragments (127 bp, 167 bp, and 192 bp) and subjected to SSCP. The 596 bp fragment amplicon of Tyr1cF and Tyr1cR was digested with the XcmI (New England Biolabs, Beverly, MA) to generate 3 smaller fragments (168 bp, 197 bp, and 229 bp) and subjected to SSCP. The three amplicons of TYR were sequenced using nested primers. For exon 1, Tyr1aR (CTCTAGGGAAATGGCCAGCGG), Tyr1bF, and Tyr1cF were used. For exon 2, Tyr2bF and Tyr2aR were used. For exon 3, Tyr3bF and Tyr3aR were used. The PCR conditions used 2.0 mM MgCl2 except for Tyr3aF and Tyr3bR which used using 1.5 mM MgCl2.
Amplified Amplicon
Primer Primer sequence (5'-3') region (bp) PCR condition
------ ------------------------- --------- -------- ------------------------
Primers for SSCP
Tyr1bF GTTCCTGCAGACCTTGTGAGG Exon 1 490 94 °C 30 s, 60 °C 30 s,
Tyr1bR GATGACATAGTCTGAGCTGATGG 72 °C 30 s for 30 cycles
Tyr1cF CTTCATGGGATTCAACTGTGG Exon 1 596 94 °C 30 s, 58 °C 30 s,
Tyr1cR GAAGTGATTGTTAAGGTTCCTCC 72 °C 30 s for 30 cycles
Tyr2bF CTACTGACTCAGTGGTGGTGAC Exon 2 346 94 °C 30 s, 60 °C 30 s,
Tyr2aR CTCCTAGGACTTTGGATAAGAG 72 °C 30 s for 30 cycles
Tyr3bF GGGATAATCACATAGGTTTTCAGTC Exon 3 268 94 °C 30 s, 64 °C 30 s,
Tyr3aR CCTCTATTTAAATCCAATGAGCACG 72 °C 30 s for 30 cycles
Primers for sequencing
Tyr1aF GTGAGCTATCCTTAGGAGTTGTC Exon 1 & 1539 94 °C 30 s, 62 °C 30 s,
Tyr1cR GAAGTGATTGTTAAGGTTCCTCC flanking 72 °C 90 s for 30 cycles
region
Tyr2aF GCCATTATCTTACAATTGCC Exon 2 & 730 94 °C 30 s, 50 °C 30 s,
Tyr2bR TGAATTATAACGTGCTGACC flanking 72 °C 1 min for 30 cycles
region
Tyr3aF GGCTCAACCTCTTTTACCTGG Exon 3 & 938 94 °C 30 s, 56 °C 30 s,
Tyr3bR CCTATAGCAGTTCTGTGTGTCC flanking 72 °C 1 min for 30 cycles
region
|