Table 2 of Hutcheson, Mol Vis 2005; 11:501-508.


Table 2. Norrie disease gene primers

Seven primers were designed for mutation screening. The forward primers are named with a terminal "F"; the reverse primers are named with a terminal "R".

                 Position
                 on contig                           Size
Exon   Primer    NT_079573   Primer sequence 5'-3'   (bp)
----   -------   ---------   ---------------------   ----
 1     NDG-01F    6682461    TGGCATTCCCATTTGCTAGT    369
       NDG-01R    6682829    AGGATGAAATGCTCGGTTTG

 2     NDG-02F    6697148    TGGGTTCCATTAGTGGTTCTG   476
       NDG-02R    6697646    GGCTTCTTGCCTGTTTCTGA

 3     NDG-03F    6705972    TGCTGTTTTACCTGGCTAAGG   350
       NDG-03R    6706321    GCTGGTCGAACTGCCTCTAC

 3     NDG-04F    6706222    CCGGTACATCCTCTCCTGTC    364
       NDG-04R    6706584    TGTATGAGGGCCCACTTTTT

 3     NDG-05F    6706518    TTGGCTCTCAATGCTGTTTG    349
       NDG-05R    6706866    GCTGTCAAGAGTTCCAGCATC

 3     NDG-06F    6706797    CAGCCAGCGAACTGACATTA    348
       NDG-06R    6707144    TTAGAGAATGATGCCCGTGA

 3     NDG-07F    6707064    GCATGCAAATTAGACAACCAA   312
       NDG-07R    6707375    AGGAGATGCTCAAGCACTAGC

Hutcheson, Mol Vis 2005; 11:501-508 <http://www.molvis.org/molvis/v11/a58/>
©2005 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535