Table 2 of
Roldan-Pallares, Mol Vis 2005;
11:461-471.
Table 2. Primer pairs for ETA, ETB, and β-actin
Primer pairs, accession code and anticipated size of the amplified product for the Endothelin Receptor A (ETA), Endothelin Receptor B (ETB) and β-actin. Primer pairs were designed with the assistance of Prism 7700 sequence detection software (Primer Express, Applied Biosystems). Agarose gel electrophoretic analysis was used to check whether the amplified products corresponded to the estimated size for cDNA fragments of β-actin, ETA and ETB receptors.
Amplicon primer Accession Forward Primer Reverse Primer Length name number (5' to 3') (5' to 3') (bp) -------- --------- ------------------------ ----------------------- ------ ETA NM_001957 GCTTCCTGGTTACCACTGA TAGTCTGCTGTGGGCAATAGTTG 84 ETB L06623 GCCAAGGACCCATCGAGAT GAAGTGTGGAGTTCCCGATGAT 98 β-actin M10277 AGATGACCCAGATCATGTTTGAGA ATAGGGACATGCGGAGACCG 86 |