Table 1 of
Tsai, Mol Vis 2005;
11:50-55.Table 1 of
Tsai, Mol Vis 2005;
11:50-55.
Table 1. Primers used for p53 gene sequencing
Primer sequences used for sequencing the p53 gene. In the "Primer name" column, all names ending with an "S" are sense primers and all names ending with "AS" are antisense primers for the different exons.
Primer name Exon Sequence (5'-3') ------ ---- --------------------- E4S 4 acctggtcctctgactgctc E4S 1 4 cagcagctcctacaccggcg E4AS 4 aggcattgaagtctcatgga E5S 5 tgccctgactttcaactctg E5AS 5 gctgctcaccatcgctatc E6S 6 ctgattcctcactgattgct E6AS 6 agttgcaaaccagacctcagg E7S 7 cctgtgttatctcctaggttg E7AS 7 gcacagcaggccagtgtgca E8S 8 gacctgatttccttactgcc E8AS 8 tctcctccaccgcttcttgt |