Table 1. PCR primer data

The primers listed were used for cloning the human GC1 promoter fragments (GenBank accession number M92432) and for genomic DNA analysis. The GCE primers were used to amplify selected fragments of the human GC1 5' flanking region. The positions of the GCE1 and GCE7 sense primers were selected to generate two fragments containing intron 1 that differ only in the size of region upstream of exon 1. The positions of the GCE7 and GCE8 antisense primers were selected to amplify two promoter fragments that contain identical regions upstream of exon 2, but that carry or lack intron 1, respectively. The nlacZ456 primer set was used to amplify a 456 bp region of the nlacZ reporter gene from mouse genomic DNA.

                             Primer sequence and position (5' to 3')
            --------------------------------------------------------------------------
Fragment                   Sense                           Antsiense
--------    --------------------------------------   ---------------------------------
  GCE1      CACTTGTTACTTTCTGGCTGA  (-680 to -700)    GGTCATTGCCGGCTT      (-9 to +6)

  GCE7      TCTGCTCCTCATCCAACATTT (-1746 to -1726)   GGTCATTGCCGGCTT      (-9 to +6)

  GCE8      TCTGCTCCTCATCCAACATTT (-1746 to -1726)   CACAGGTCTTCCTTGCCA (-403 to -386)

nlacZ456    GCGCACGGCGTTAAAGTTGTTCTG                 CGCGCTGTACTGGAGGCTGAA