Table 1 of
Bennett, Mol Vis 2004;
10:376-382.Table 1 of
Bennett, Mol Vis 2004;
10:376-382.
Table 1. PCR primers for mutation screening of GJA3
Primer pairs used for amplification and sequencing of the coding exon for GJA3 located on 13q.
Location Strand Sequence (5'-3') -------------- --------- ---------------------- 5' non-coding Sense TGCGGACCCGGCACTCAGC Codons 223-229 Antisense CTTCTTCCAGCCCAGGTGGTA Codons 29-36 Sense CTGTTCATCTTCCGCATTTTGG Codons 96-103 Antisense TCCATGCGCACGATGTGCAGCA Codons 182-189 Sense ACCGCTGGCCCTGCCCCAACAC 3' non-coding Antisense TCTTCTTCCAGCCCAGGTGGTA |