Table 1 of Ottino, Mol Vis 2004; 10:341-350.


Table 1. Primer sequences and amplification conditions

The sequences listed in the table correspond to primers taken from the cited references.

                                                                            Optimal
                                                                Annealing    cycle    Product
       Gene                          Primer sequence            temp (°C)   number     size
--------------------------   --------------------------------   ---------   -------   -------
Collagenase (MMP-1) [26]     tcagttcgtcctcactccag                  55         32        322
                             ttggtccacctgtcatcttc
Gelatinase A (MMP-2) [26]    cccccaaaacggacaaagag                  60         35        315
                             cacgagcaaaggcatcatcc
Gelatinase B (MMP-9) [26]    aaactggatgacgatgtctgcgtcccg           58         35        362
                             acctgttccgctatggttacacccgcgta
TIMP-2 [26]                  gtagtgatcagggccaaag                   60         35        416
                             ttctctgtgacccagtccat
MT1-MMP [46]                 gcccattggccagttctggcggg               55         35        530
                             cctcgtccacctcaatgatgatc
VEGF165 [27]                 cttgctgctgtacctccaccat                60         35        341
                             tgttgtgctgtaggaagctcatct
VEGF A (all isoforms) [47]   gcggaattcatcatgcggatcaaacctcacca      65         30        470
                             tacggatcctccggacccaaagtgctc
FLT-1 [48]                   cccacttgccatcataagg                   60         35        483
                             caccatacctcctgcgaaacct
KDR [49]                     atagatggtgtaacccggagtgac              62         35        360
                             tgggattggtaaggatgacagtgt
NP-1 Receptor [50]           caacgataaatgtggcgatact                62         35        820
                             tatactgggaagaagctgtgat

Ottino, Mol Vis 2004; 10:341-350 <http://www.molvis.org/molvis/v10/a43/>
©2004 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535