Table 1 of Koizumi, Mol Vis 2004; 10:328-340.


Table 1. RT-PCR primers

The outer primers were used for reverse transcription and the first-round PCR. A common outer primer pair was used to amplify mRNAs for HCN2-4. The inner primers were used for the nested second-round PCR. HCN2-4 were amplified using gene specific forward primers and a common reverse primer.

                                                    Size
Primer name    Primer sequence                      (bp)
------------   ----------------------------------   ----
HCN1 outer     Forward: GTCTCTTGCGGTTATTACGCCTT        -
               Reverse: CACGAAATTGGGATCGGCGTTAG

HCN2-4 outer   Forward: GTGGGCATCACTTTCTTCAAGGA        -
               Reverse: CGGGCAGCTTGTGGAAGGACATGTA

HCN1 inner     Forward: CGCCTTTCAAGGTTAATCAGATA      404
               Reverse: CTTGAAGAGTCCAAAGACTGG

HCN2 inner     Forward: TCCGCACCGGCATTGTTATT         658
               Reverse: TGCTTGTACTTCTCCTGGTA

HCN3 inner     Forward: CGCCAAGGGCCATCCGAACGCGT      619
               Reverse: TGCTTGTACTTCTCCTGGTA

HCN4 inner     Forward: TCAAGATGAAGTACCTGAAA         604
               Reverse: TGCTTGTACTTCTCCTGGTA

Koizumi, Mol Vis 2004; 10:328-340 <http://www.molvis.org/molvis/v10/a42/>
©2004 Molecular Vision <http://www.molvis.org/molvis/>
ISSN 1090-0535