Return to Bernstein et al

Figure 2

Identification of Mitochondrial Gene Sequences

Panel A)

Schematic of the mitochondrial genome

Panel B)

Primer pairs used to synthesize the PCR-based mitochondrial DNA probes. Sequence information used to make the primers was based on sequence information available through GenBank (Accession numbers J01415, M12548, M58503, M63932-33). Mitochondrial DNA used in the PCR reactions was obtained from normal human erythrocytes. Individual PCR reactions incorporating a single set of primers were performed, and the amplified DNA from eight reactions were combined and labeled as described in Methods.

                                      Genome     PCR Product
     #     Primer sequence            position     size (bp)
    ____________________________________________________________

     1    5'GATCACAGGTCTATCACCCTA3'    1
          5'ACCTATAAATCTTCCCACTAT3'    1984         1984

     2    5'CGAGCCTGGTGATAGCTGGTT3'    2001
          5'GTATTCGGCTATGAAGAATAG3'    3990         1989

     3    5'TATAATAAACACCCYCACCAC3'    4002
          5'GCCGAATAATAGGTATAGTGT3'    5973         1989

     4    5'AGCCTCCTTATTCGAGCCGAG3'    6003
          5'TCGCAGGTCGCCTGGTTCTAG3'    7986         1983

     5    5'ACAATCGAGTAGTACTCCCGA3'    8001
          5'CAATAGATGGAGACATACAGA3'    9979         1978

     6    5'AATAGTACCGTTAACTTCCAA3'    10004
          5'AATAGTACCGTTAACTTCCAA3'    11976        1973

     7    5'TCACTCACCCACCACATTAAC3'    12011
          5'AGGTAATAGCTTTTCTAGTCAG3'   14026        2015

     8    5'CACCTCCATCATCACCTCAAC3'    14052
          5'TCGGATACAGTTCACTTTAGCT3'   16498        2446

Panel C)

Screening of the Secondary Blots with the mixed mitochondrial DNA probe. Clones generating strong signals were eliminated from further analysis.

Return to Bernstein et al